Sökresultat

Norge drabbas årligen av hundratals jordskred vilket leder till betydande ekonomisk skada och fara för liv. Därför bedriver norska myndigheter och forskningsinstitutioner omfattande forskning om jordskred och vidtar åtgärder för att övervaka, modellera och slutligen mildra konsekvenserna av och förebygga dessa. Som en del av sitt arbete underhåller norska vattenresurs- och energimyndigheten en natNorway experiences hundreds of landslides annually which leads to significant economic losses and poses a threat to human life. Therefore, Norwegian authorities and scientific institutions are conducting extensive research and take measures in the fields of documenting, modelling and ultimately mitigating and preventing landslides. As part of its work, the Norwegian Water Resources and Energy Dire

Purpose: To propose a blueprint of how the policymakers responsible for health care reforms in the county of Scania (Sweden) could evaluate a prospective stroke care intervention from a societal point of view. More specifically, the intervention will consist in the introduction of telemedicine technology to their ambulance fleet. In addition, key methodological issues, of interest to the policymak

Med anledning av offentlig upphandling kan det emellanåt förekomma att leverantören på olika sätt vilseleder myndigheten för att på oriktig grund antingen teckna ramavtal med myndigheten eller av myndigheten erhålla ett upphandlingskontrakt. Problematiken med olika former av vilseledande får antas vara större vid offentlig upphandling än vid vanliga B2B-relationer på grund av det strikta regelverkOccasionally when a contracting authority is about to award a public contract or conclude a framework agreement with a supplier, the supplier somehow misleads the contracting authority in order to receive the public contract or the framework agreement. Due to the rigorous regulatory system that distinguish public procurement one can expect the misleading to be a problem of greater importance than

We apply the statistical sparse jump model, a recently devel-oped, interpretable and robust regime switching model, to infer key featuresthat drive the return dynamics of the largest cryptocurrencies. The algorithmjointly performs feature selection, parameter estimation, and state classifica-tion. Our large set of candidate features are partly based on cryptocurrency,sentiment and financial market We apply the statistical sparse jump model, a recently devel-oped, interpretable and robust regime switching model, to infer key featuresthat drive the return dynamics of the largest cryptocurrencies. The algorithmjointly performs feature selection, parameter estimation, and state classifica-tion. Our large set of candidate features are partly based on cryptocurrency,sentiment and financial marke

Popular Abstract in English ...GTAAAAATTAAGCACAGTGGAAGAATTTCATTCTGTTCTCAGTTTTCCTGGAT TATGCCTGGCACCATTAAAGAAAATATCTTTGGTGTTTCCTATGATGAATATAGATACA GAAGCGTCATCAAAGCATGCCAACTAGAAGAG1.... The string of these block letters (A, T, C and G) is a tiny part of the human DNA sequence, which is more than 3 billion letters long. The combination of these block letters carries genetic information, similar to howThe importance of nucleic acids in pure form for preparative and analytical perspectives, have increased constantly, demanding the development of new and more efficient methods for their recovery and isolation. This thesis describes a series of different innovative methods for recovery and purification of these biomolecules. In a general overview of a downstream processing, there are several criti

Popular Abstract in Swedish Forskningen som presenteras i denna avhandling fokuserar på tillverkning av små strukturella enheter (komponenter) samt tillämpning av ny teknologi för att adressera viktiga medicinska forskningsfrågeställningar. Framtagande av teknologi som använder sig av komponenter som är tusentals gånger mindre än bredden på ett hår är svårt men möjligt. Denna avhandling fokuserar This thesis focuses on the study of thin-film sensor technologies, novel microfabrication technologies, and thin-film technology in general. The work discusses electrochemical sensors and mechanical sensor technologies as well as fabrication strategies for them. Also included are mechano-chemical studies of the vancomycin DAla (Bacteria membrane analogue motif ) binding reaction in different chemica

Information on past land cover in terms of absolute areas of different landscape units (forest, open land, pasture land, cultivated land, etc.) at local to regional scales is needed to test hypotheses and answer questions related to climate change (e.g. feedbacks effects of land-cover change), archaeological research, and nature conservancy (e.g. management strategy). The palaeoecological techniqu

This thesis is a study of configurations of identity in American mainstream comics. It focuses on how a small number of writers of Jewish descent have expressed or disciplined their Jewishness in relation to their creations. In an attempt to revise common linear narratives, the thesis presents three case studies of famous and influential comics texts with different primary foci: a chapter on SuperPopular Abstract in English The publication of Michael Chabon’s Pulitzer-prize winning novel The Amazing Adventures of Kavalier & Clay (2000) brought the Jewish–comics connection to popular attention. The novel illuminated the fact that many of the pioneers of American mainstream comics were Jewish. Owing to this history, and to the fact that there today exists a large and growing library of s

njursvikt – Vetenskap och Hälsa Hoppa till innehåll Vetenskap och hälsa Populärvetenskapligt om medicinsk forskning i Skåne Teman Podd Tidskrift Prenumerera Om webbplatsen Kontakt Sök Sök Etikett: njursvikt Ökad kunskap om hormonsystemet ger diabetesforskare nya svar 2023-02-03 Hur mycket vatten behöver vi dricka för att vi ska hålla oss friska? Vilken effekt får olika dieter på ämnesomsättningen?

https://www.vetenskaphalsa.se/tag/njursvikt/ - 2026-07-17

Background: For up to 50% of adolescents experiencing PTSD, the course of their illness is further complicated by co-occurring substance use. Despite this, evidence-based integrated treatment options for adolescents with this comorbidity remain sparse. To address this gap, we are conducting an RCT examining the efficacy of exposure-based therapy for co-occurring PTSD and substance use among adoles

Abstract (Swedish) Vägföreningen Vikhögs Uddeväg har under lång tid upplevt problem och risker med kusterosion för sin privata väg. Denna studie ämnar utreda vilka förutsättningar som ligger bakom problemen och hur problemen kan utvecklas i framtiden. Studien ämnar också undersöka vilka resurser som finns tillgängliga i samhället för små kustsamhällen att använda sig av för att skydda sin egendom

Denna masteruppsats studerar den nuvarande upphovsrätten inom EU och fastställer om det för närvarande finns skydd för AI-producerade verk. Det finns möjlighet att skydda verk som har blivit skapade av AI-system om det finns en länk mellan den mänskliga upphovsmannen och det slutliga verket. I detta fall betraktas AI-systemet som ett redskap för att skapa ett specifikt alster. Om länken mellan den

This thesis explores the philosophical implications of commodification, focusing on the claim made by Jason Brennan and Peter Jaworski in Markets Without Limits (2013) that ”if you can have it, you can buy it; if you can give it away, you can sell it.” Their thesis argues for the moral permissibility of commodifying any good or service that is already permissible to exchange without monetary compe

This paper, inspired by the writings of Mats Roslund, discusses the use of archaeological materials that were once collected without proper excavation and documentation techniques. The case study used is the material from the moats at the castle Glimmingehus, collected when the moats were emptied in the years 1935–1937. By today’s standards, the material has major shortcomings regarding documentat

Background: The incidence of detected ductal carcinoma in situ (DCIS) continues to increase and now accounts for 14% of all breast cancer, and 20%–25% of screen-detected cases. Treatment trends of DCIS are important in order to inform the ongoing debate about possible overdiagnosis and overtreatment, but have not been investigated for over a decade in Australia and New Zealand. Against this backgr

This paper presents a receiver front end with improved blocker handling implemented in a 65-nm CMOS technology. Since close-in blockers are challenging to reject at RF, the receiver features a baseband (BB) notch filter, which effectively sinks close-in blocker current directly from the output of an LNTA and passive mixer structure. The notch-filter frequency can be tuned to match the blocker offs

Background: For up to 50% of adolescents experiencing PTSD, the course of their illness is further complicated by co-occurring substance use. Despite this, evidence-based integrated treatment options for adolescents with this comorbidity remain sparse. To address this gap, we are conducting an RCT examining the efficacy of exposure-based therapy for co-occurring PTSD and substance use among adoles

Task level programming based on skills has often been proposed as a mean to decrease programming complexity of industrial robots. Several models are based on encapsulating complex motions into self-contained primitive blocks. A semantic skill is then defined as a deterministic sequence of these primitives. A major limitation is that existing frameworks do not support the coordination of concurrentTask level programming based on skills has often been proposed as a mean to decrease programming complexity of industrial robots. Several models are based on encapsulating complex motions into self-contained primitive blocks. A semantic skill is then defined as a deterministic sequence of these primitives. A major limitation is that existing frameworks do not support the coordination of concurrent